| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.116152 |
| Chromosome: | chromosome 6 |
| Location: | 2448801 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g268700 | POB28 | Proteome of basal body 28; (1 of 1) PTHR18937//PTHR18937:SF224 - STRUCTURAL MAINTENANCE OF CHROMOSOMES SMC FAMILY MEMBER // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGGCCTCCAGATCCGCGCGCTGAGCCAT |
| Internal bar code: | CTAAGTGCTTACGTCGATCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 821 |
| LEAP-Seq percent confirming: | 98.7909 |
| LEAP-Seq n confirming: | 7272 |
| LEAP-Seq n nonconfirming: | 89 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGGGGAGAAGGAAAAGAC |
| Suggested primer 2: | CTAGTCCAACCCGCTTACCA |