| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.116189 |
| Chromosome: | chromosome 9 |
| Location: | 5116579 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g398808 | (1 of 2) PF01465 - GRIP domain (GRIP) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCAGGGCTGTCCTGGGTGATGGACAGGA |
| Internal bar code: | GGGGAACTAGGGATTCAATGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 137 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 384 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACATATACACACGAGCGG |
| Suggested primer 2: | CTTACCTTCGCAACTACGCC |