| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.116297 |
| Chromosome: | chromosome_10 |
| Location: | 4559524 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre10.g452400 | CSF1 | Predicted protein of CSF family | antisense | 3'UTR |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | CCCTGAGACTGGTCTGTCTCTCTCGTCTCA |
| Internal bar code: | GGTAGAAAGAAGCCCTCAACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 487 |
| LEAP-Seq percent confirming: | 99.8224 |
| LEAP-Seq n confirming: | 1686 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAGACCTCAGCCCTTCAC |
| Suggested primer 2: | ACAATCTGCTGGCACAACTG |