| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.116401 |
| Chromosome: | chromosome 1 |
| Location: | 4656477 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g032050 | UAA1 | UDP-galactose/glucose transporter; (1 of 1) K15275 - solute carrier family 35 (UDP-galactose transporter), member B1 (SLC35B1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAATGATCCGTCTCGCGCGCGCTGGCTGC |
| Internal bar code: | ATCAGAACGACCAGGCGCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 655 |
| LEAP-Seq percent confirming: | 99.1878 |
| LEAP-Seq n confirming: | 1954 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTACGCCGCCTACATGTTC |
| Suggested primer 2: | TGTTACTTCACCGCAACAGG |