Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.116403 |
Chromosome: | chromosome 10 |
Location: | 6281013 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g464950 | (1 of 1) K15201 - general transcription factor 3C polypeptide 3 (transcription factor C subunit 4) (GTP3C3, TFC4) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACACGATTGCACGCCGGCCTTTGCTCCTC |
Internal bar code: | CGTAGACTTGTTAAGATACACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 285 |
LEAP-Seq percent confirming: | 99.7308 |
LEAP-Seq n confirming: | 3334 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAACCCCTTCTTCCCCAATC |
Suggested primer 2: | TCACGCCAAACTGAGAGTTG |