| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.116447 |
| Chromosome: | chromosome 10 |
| Location: | 4993095 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g455300 | SMP1 | (1 of 1) K11088 - small nuclear ribonucleoprotein D3 (SNRPD3, SMD3); Small nuclear ribonucleoprotein SmD3 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCTGTAGGGCAAATCTTCTAGAGCTAAG |
| Internal bar code: | CAGTTCCTCGGGACGTGTCATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 766 |
| LEAP-Seq percent confirming: | 99.8756 |
| LEAP-Seq n confirming: | 1606 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACAAGTGTGGGACCAAGC |
| Suggested primer 2: | AGCTATACGGCTGGTGGCTA |