| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.116488 |
| Chromosome: | chromosome 10 |
| Location: | 921169 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g424450 | TOM40 | 40 kDa translocon at mitochondrial outer envelope membrane; (1 of 1) K11518 - mitochondrial import receptor subunit TOM40 (TOM40) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGGGCCTACCAGCGCTACCCCGCGGCAG |
| Internal bar code: | ATCGAGGGCGCAGCTGTTTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 381 |
| LEAP-Seq percent confirming: | 99.7558 |
| LEAP-Seq n confirming: | 6944 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGATTGTGCGACAGGAAGA |
| Suggested primer 2: | AGCACTAGGTCGGCATTGAC |