| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.116670 |
| Chromosome: | chromosome 3 |
| Location: | 5186621 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g182500 | SRP72 | (1 of 1) K03108 - signal recognition particle subunit SRP72 (SRP72); Subunit of the Signal Recognition Particle | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTAGGTCTGCTCACTGAGTCACTTCTCT |
| Internal bar code: | ATGAGAACTTGAGTAGGACAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1170 |
| LEAP-Seq percent confirming: | 99.7597 |
| LEAP-Seq n confirming: | 3737 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGTATAGCAAGGGGTGCG |
| Suggested primer 2: | GTACGAGGGAGGAAGGAAGG |