| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.116733 |
| Chromosome: | chromosome 16 |
| Location: | 2815171 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663200 | FAP295 | (1 of 2) PTHR24353//PTHR24353:SF37 - CYCLIC NUCLEOTIDE-DEPENDENT PROTEIN KINASE // PROTEIN KINASE DC1-RELATED; Flagellar Associated Protein 295 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAAGACCTGGCGGTCCAGGGCCCACACCA |
| Internal bar code: | TAGCGGCCCAGATGACTAGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 830 |
| LEAP-Seq percent confirming: | 92.0096 |
| LEAP-Seq n confirming: | 3063 |
| LEAP-Seq n nonconfirming: | 266 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCACCTGGTTCGACTTT |
| Suggested primer 2: | CTGTAATGTGCGTGGATTGG |