| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.116758 |
| Chromosome: | chromosome 1 |
| Location: | 2146822 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g011660 | (1 of 14) PTHR10334 - CYSTEINE-RICH SECRETORY PROTEIN-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCACTTACGCCGACCCCCTCACTGCCACC |
| Internal bar code: | GTCGTCTAGTTAATCAGAAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 471 |
| LEAP-Seq percent confirming: | 98.5882 |
| LEAP-Seq n confirming: | 3352 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGAGTCACCCACACTACCT |
| Suggested primer 2: | ATACAAACGGACGTTCCGAG |