Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.116765 |
Chromosome: | chromosome 17 |
Location: | 5888559 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g739950 | (1 of 1) PF01612//PF13086//PF13087 - 3'-5' exonuclease (DNA_pol_A_exo1) // AAA domain (AAA_11) // AAA domain (AAA_12) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGGCCGCGCACGGGAGGCATGTGCCTGT |
Internal bar code: | GGAAGGGATGAGGTGGGGGATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 685 |
LEAP-Seq percent confirming: | 99.7865 |
LEAP-Seq n confirming: | 1402 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTACATCTCCCGACTGAT |
Suggested primer 2: | CGTTTTAGACTCCGCGTTTC |