| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.116792 |
| Chromosome: | chromosome 11 |
| Location: | 1781901 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467400 | (1 of 3) IPR000104//IPR001859 - Antifreeze protein, type I // Trypanosoma cruzi ribosomal protein P2-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTCACTCACTGGCATATGATGAGTGGTG |
| Internal bar code: | TCGAGTTTAGGCTGAGGTCACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 872 |
| LEAP-Seq percent confirming: | 97.6157 |
| LEAP-Seq n confirming: | 3521 |
| LEAP-Seq n nonconfirming: | 86 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTGGTGATGGTGTGCTTT |
| Suggested primer 2: | TTTTGTGAGCAATTTGCAGC |