| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.116822 |
| Chromosome: | chromosome 11 |
| Location: | 1519827 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467747 | (1 of 2) PF10173 - Mitochondrial K+-H+ exchange-related (Mit_KHE1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAGCGTGGCGGCGGCGCGGCCTCAGGGG |
| Internal bar code: | CACCGCAAAAGGGGGTCAAAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 451 |
| LEAP-Seq percent confirming: | 99.6788 |
| LEAP-Seq n confirming: | 8379 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGGATGCATTACAAAATCC |
| Suggested primer 2: | TTCGTTCTTCGAGCAATGTG |