Insertion junction: LMJ.RY0402.116824_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.116824
Chromosome:chromosome_12
Location:6953225
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre12.g560350 CNK2 NimA-related protein kinase sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CAGGTGTGCATGTGTGTCAGAGCGTGTCGG
Internal bar code:GGGACCGGATCACTATGCTGGA

Confirmation - LEAP-Seq

LEAP-Seq distance:484
LEAP-Seq percent confirming:99.3775
LEAP-Seq n confirming:3991
LEAP-Seq n nonconfirming:25
LEAP-Seq n unique pos:17

Suggested primers for confirmation by PCR

Suggested primer 1:ACTCGTACACCTCGGACACC
Suggested primer 2:TTGTGGTAGAACGCACCGTA