Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.116946 |
Chromosome: | chromosome 7 |
Location: | 4637197 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g344300 | (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCCGGAGCTGCTCGCTGGAGTTGTCTT |
Internal bar code: | GTGGCACCTTGTAGGGGCGATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 465 |
LEAP-Seq percent confirming: | 96.9213 |
LEAP-Seq n confirming: | 850 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGGAAGGGATGAGAGGATG |
Suggested primer 2: | CTCCTCCTTTCCTGCTCCTT |