Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.117005 |
Chromosome: | chromosome 2 |
Location: | 7447580 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g144300 | TPT6,TPT7 | (1 of 4) K15285 - solute carrier family 35, member E3 (SLC35E3); UDP-rhamnose/galactose transporter | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAACTCGCCCTCATGCTTGATGCGTGGCT |
Internal bar code: | GTACATATCGATGTGCATTTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 494 |
LEAP-Seq percent confirming: | 99.472 |
LEAP-Seq n confirming: | 5652 |
LEAP-Seq n nonconfirming: | 30 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGAGCGCCTATCAATCAT |
Suggested primer 2: | TACCAGCCCAAACTAAACCG |