| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.117037 |
| Chromosome: | chromosome 1 |
| Location: | 2790329 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g016542 | (1 of 1) IPR000104//IPR029063 - Antifreeze protein, type I // S-adenosyl-L-methionine-dependent methyltransferase | intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCGCCGCCCGGCACTGTTCTGCTGCCC |
| Internal bar code: | AGGGAGTGCCACGCGAGGGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 456 |
| LEAP-Seq percent confirming: | 93.1555 |
| LEAP-Seq n confirming: | 1851 |
| LEAP-Seq n nonconfirming: | 136 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGATGAGATGCGACAAG |
| Suggested primer 2: | CCCACACCTTCCACAACTCT |