| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.117258 |
| Chromosome: | chromosome 7 |
| Location: | 1039875 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g319550 | (1 of 1) PF10442 - FIST C domain (FIST_C) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGACCTAGCCAATATAGCTGCTCCCATGT |
| Internal bar code: | CTGATTATTCCGATGTCTACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 236 |
| LEAP-Seq percent confirming: | 99.3143 |
| LEAP-Seq n confirming: | 869 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGTCTGCTCAGGAGTAAG |
| Suggested primer 2: | GTCGAGGACTAAGGCTGTCG |