| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.117322 |
| Chromosome: | chromosome 2 |
| Location: | 7868910 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g141700 | FAP315 | (1 of 2) PTHR12932//PTHR12932:SF9 - P25 ALPHA-RELATED // TPPP FAMILY PROTEIN CG45057; EF-Hand Containing Flagellar Associated Protein 315 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTGTCCCACGTCCACCACTCCACCCTCC |
| Internal bar code: | CCCCGCTTGGCGGAGACGGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 23 |
| LEAP-Seq percent confirming: | 99.0741 |
| LEAP-Seq n confirming: | 535 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGTGGTAGTGTCAACCGC |
| Suggested primer 2: | CATGCACAAATCACCAAAGG |