| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.117338 |
| Chromosome: | chromosome 9 |
| Location: | 6470976 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g407250 | FAP270 | (1 of 3) PTHR24193//PTHR24193:SF87 - ANKYRIN REPEAT PROTEIN // SUBFAMILY NOT NAMED; Flagellar Associated Protein 270 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCACCGTTCTCACCCTCTCCGTCGCTTAT |
| Internal bar code: | TCCTCGGTAGTTGTTTCTCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 221 |
| LEAP-Seq percent confirming: | 97.5 |
| LEAP-Seq n confirming: | 156 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGCGCACTACTCTCGCCT |
| Suggested primer 2: | CAAAGCTAATCCCCTCCCTC |