| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.117354 |
| Chromosome: | chromosome 7 |
| Location: | 6336797 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g357250 | protein of unknown function; (1 of 1) PTHR24188//PTHR24188:SF41 - ANKYRIN REPEAT PROTEIN // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGCGCTCACGCAGTCCAGCCCGTCCGC |
| Internal bar code: | TAGTGCGGCAACGTGGTTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 453 |
| LEAP-Seq percent confirming: | 84.4492 |
| LEAP-Seq n confirming: | 1564 |
| LEAP-Seq n nonconfirming: | 288 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAACACCTGTCCGTGCTC |
| Suggested primer 2: | GCTGGTTGTGATGTTGAGGA |