Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.117408 |
Chromosome: | chromosome 9 |
Location: | 7262735 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g412600 | CYG52 | (1 of 1) PF00072//PF00211 - Response regulator receiver domain (Response_reg) // Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc); Adenylate/guanylate cyclase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTTTGCAAGCATGTTTGGAAAAGCGGTA |
Internal bar code: | AATTAGCGCGGGTTGGTCTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 587 |
LEAP-Seq percent confirming: | 98.9749 |
LEAP-Seq n confirming: | 2607 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATGCGTGTGGAATGTGTC |
Suggested primer 2: | GAGTACGAAGTGCTGGAGGC |