| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.117541 |
| Chromosome: | chromosome 3 |
| Location: | 1626008 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g152850 | PAM,PAM1 | (1 of 1) 1.14.17.3//4.3.2.5 - Peptidylglycine monooxygenase / Peptidylglycine alpha-amidating monooxygenase // Peptidylamidoglycolate lyase / Alpha-hydroxyglycine amidating dealkylase; bioactive peptide amidating enzyme | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGCGGGGGGGGGGTAAATACCAGCCCA |
| Internal bar code: | CATCATGCAACGCGAGGCTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5 |
| LEAP-Seq percent confirming: | 92.9368 |
| LEAP-Seq n confirming: | 250 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTGAGCAGAATGCATAAA |
| Suggested primer 2: | GCGTGTAAAGTGCTTGGTGA |