Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.117657 |
Chromosome: | chromosome 8 |
Location: | 4551104 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g382800 | CDPK13 | (1 of 1) PF00036//PF07714//PF13499 - EF hand (EF-hand_1) // Protein tyrosine kinase (Pkinase_Tyr) // EF-hand domain pair (EF-hand_7); Calcium/calmodulin-dependent protein kinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGAATGTAACCCCCGCCCCGCCGCCCCG |
Internal bar code: | GTCCGCAGTGTCACGTCCCCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 352 |
LEAP-Seq percent confirming: | 89.6739 |
LEAP-Seq n confirming: | 165 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTGTAGTGCATCGCCACTG |
Suggested primer 2: | GCAGCAGGTCAAAGAACTCC |