| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.117668 |
| Chromosome: | chromosome 13 |
| Location: | 5051012 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g607000 | XHP1 | (1 of 1) PTHR11014:SF54 - CYTOSOL NON-SPECIFIC DIPEPTIDASE; Xaa-His dipeptidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGACGAGTAACAATGTGGCTTCGCTCAAA |
| Internal bar code: | GCTGGCGTTTATGCAACGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 634 |
| LEAP-Seq percent confirming: | 99.543 |
| LEAP-Seq n confirming: | 1307 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGTGAGCTCCTTGTAGGC |
| Suggested primer 2: | GATTGGTTAGCGCTCGGTTA |