| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.117769 |
| Chromosome: | chromosome 6 |
| Location: | 5065201 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280500 | PPP23 | (1 of 1) PTHR23081//PTHR23081:SF1 - RNA POLYMERASE II CTD PHOSPHATASE // RNA POLYMERASE II C-TERMINAL DOMAIN PHOSPHATASE-LIKE 2; Phosphoprotein phosphatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCGGAGGCGGGCCTCCTGTGGCGGGGCT |
| Internal bar code: | GGGAAGCGTGGGGCGCGGGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 266 |
| LEAP-Seq percent confirming: | 99.8773 |
| LEAP-Seq n confirming: | 814 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGATGACGACGACTACGA |
| Suggested primer 2: | ATCAGCGAGGCGAGTAGGTA |