| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.117805 |
| Chromosome: | chromosome 12 |
| Location: | 8839514 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g545000 | ARP7 | (1 of 1) K16615 - actin-related protein 7, plant (PARP7); Actin-related protein, putative SWR-C component | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCCTCATCGGAAGCTGCTAGAGCACCAC |
| Internal bar code: | ATCTGACAATCAGGTAAGCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 798 |
| LEAP-Seq percent confirming: | 99.9322 |
| LEAP-Seq n confirming: | 1473 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGGTTTTACCGCATTGCT |
| Suggested primer 2: | CAGTACAGCTGCAAGAAGCG |