| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.117896 |
| Chromosome: | chromosome 3 |
| Location: | 6714560 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g197700 | HLM8 | (1 of 1) PTHR13793//PTHR13793:SF100 - PHD FINGER PROTEINS // HISTONE-LYSINE N-METHYLTRANSFERASE ATX1-RELATED; Histone-lysine N-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCCGCACTTCGGCACATGGCGGAGCTGA |
| Internal bar code: | GCTGACTGGTTCGGAATGCGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 691 |
| LEAP-Seq percent confirming: | 99.7925 |
| LEAP-Seq n confirming: | 1924 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAAGCAATACCACGAGCTG |
| Suggested primer 2: | CATCACCGTGTCCTGATCC |