| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.117898 |
| Chromosome: | chromosome 1 |
| Location: | 4881074 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g033832 | HEL7,RH39 | Possible DEAD-box helicase involved in creation of hidden rRNA breaks in chloroplast ribosomes; (1 of 1) PTHR24031//PTHR24031:SF247 - RNA HELICASE // DEAD-BOX ATP-DEPENDENT RNA HELICASE 39 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGAGGTGCGCGCGCGACCTCTACGGATG |
| Internal bar code: | GCGGTTGGATGGAGTGGTCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 169 |
| LEAP-Seq percent confirming: | 99.8924 |
| LEAP-Seq n confirming: | 928 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACTGCAGACGAAGTCGGT |
| Suggested primer 2: | CACACTACCAACATGACCGC |