Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.117927 |
Chromosome: | chromosome 2 |
Location: | 5818825 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g111000 | RRA1,CGL9 | (1 of 3) PTHR10994//PTHR10994:SF3 - RETICULON // ARABINOSYLTRANSFERASE; Reduced residual arabinose 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTGCGCCCGCACCGTCAATAGCCCATCC |
Internal bar code: | ACACTCGGATCCATACGTAAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 885 |
LEAP-Seq percent confirming: | 99.7389 |
LEAP-Seq n confirming: | 1146 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTAGCAATCCTGAATGGGA |
Suggested primer 2: | GTGTTGCAGGTGTGGAAATG |