| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.118072 |
| Chromosome: | chromosome 6 |
| Location: | 7741476 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g302050 | GSL2,BGS5,BGS6,GTR12 | Glucan synthase-like 2; (1 of 4) K00706 - 1,3-beta-glucan synthase (E2.4.1.34) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTGACCTACGCCGGCTCATCATGTATG |
| Internal bar code: | TCGTGAAATCTGGGGACACCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 384 |
| LEAP-Seq percent confirming: | 90.1472 |
| LEAP-Seq n confirming: | 796 |
| LEAP-Seq n nonconfirming: | 87 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGTTCCTGTTCCTGTCGG |
| Suggested primer 2: | CGAATACCGTGTCAGTGGTG |