| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.118094 |
| Chromosome: | chromosome 6 |
| Location: | 1696459 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g261350 | (1 of 1) PF06108 - Protein of unknown function (DUF952) (DUF952) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGGAAGCCTGAATGGCACCTGTCACAA |
| Internal bar code: | AACAACGTGTTCTCCGGAGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 480 |
| LEAP-Seq percent confirming: | 99.9337 |
| LEAP-Seq n confirming: | 1507 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCAACCCCTGTGGAGTCT |
| Suggested primer 2: | TGCTGGTGCTGGACTATGAG |