| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.118410 |
| Chromosome: | chromosome 10 |
| Location: | 1295858 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427350 | CYP31,CYP39A2 | Cytochrome P450, CYP213 superfamily; (1 of 1) 1.14.13.79 - Ent-kaurenoic acid oxidase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCTGTGTGCTCCTTCAGGGCTCGGTGC |
| Internal bar code: | GGGAGTTGCACTATGTTTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1261 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 135 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCTGTGCGGTGTTCATGT |
| Suggested primer 2: | CAAGGGAATACAGCCCGTAA |