| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.118428 |
| Chromosome: | chromosome 6 |
| Location: | 1744929 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g261900 | FAP71 | (1 of 7) PF07004 - Sperm-tail PG-rich repeat (SHIPPO-rpt); Flagellar Associated Protein 71 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTACACCACGACTACCCCTAGAATCGTG |
| Internal bar code: | GGCACTGTATGCGGAAGTTGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1378 |
| LEAP-Seq percent confirming: | 99.3968 |
| LEAP-Seq n confirming: | 5932 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGTGGACTGGGAAATTCG |
| Suggested primer 2: | CCAGCTCCTCAGAGACAACC |