| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.118473 |
| Chromosome: | chromosome 6 |
| Location: | 3119713 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g275150 | CGL69,TGL11 | (1 of 1) PTHR21493//PTHR21493:SF84 - CGI-141-RELATED/LIPASE CONTAINING PROTEIN // F21O3.11 PROTEIN; conserved protein with lipase motif | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGCTAACATAACGGTGCACTCCGATCT |
| Internal bar code: | TACGTTCCACGCTTGTCTAGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 222 |
| LEAP-Seq percent confirming: | 94.3804 |
| LEAP-Seq n confirming: | 3846 |
| LEAP-Seq n nonconfirming: | 229 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCTGGTGGTGGAAGAGG |
| Suggested primer 2: | TCTCAGCTTTGTTGTGACCG |