Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.118481 |
Chromosome: | chromosome 16 |
Location: | 3810249 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g689550 | PTK8 | Putative tyrosine kinase; (1 of 10) PTHR23257//PTHR23257:SF520 - SERINE-THREONINE PROTEIN KINASE // IP11267P | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAACAGCAACATTGGCGGATTCAACCAC |
Internal bar code: | CAAGGGGCCACTAATTTGCGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 997 |
LEAP-Seq percent confirming: | 98.9604 |
LEAP-Seq n confirming: | 9424 |
LEAP-Seq n nonconfirming: | 99 |
LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATAGGTCTACGGCACGGTT |
Suggested primer 2: | TTATATCAAAGCGTTCGCCC |