Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.118492 |
Chromosome: | chromosome 3 |
Location: | 5539052 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g186200 | CDS1,PCT1 | Phosphatidate cytidylyltransferase; (1 of 1) PTHR13773:SF8 - PHOSPHATIDATE CYTIDYLYLTRANSFERASE, PHOTORECEPTOR-SPECIFIC | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCACGCTTCCACTCTCGCACCCTTTAGA |
Internal bar code: | CGCGTCCTCGGTACCGGACTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 743 |
LEAP-Seq percent confirming: | 99.9496 |
LEAP-Seq n confirming: | 3964 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGGTATCAGGCACACAGC |
Suggested primer 2: | TAGCAGTAGCCGCAGCAGTA |