| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.118513 |
| Chromosome: | chromosome 12 |
| Location: | 7381052 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g556911 | MRE11 | Double-strand break repair protein MRE11; (1 of 1) K10865 - double-strand break repair protein MRE11 (MRE11) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTCTTTAACACATATAAATACACATGCA |
| Internal bar code: | TCGTTCATTGCCCCCCAGTAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 420 |
| LEAP-Seq percent confirming: | 99.7053 |
| LEAP-Seq n confirming: | 8120 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACAGGACTGTGAATGGG |
| Suggested primer 2: | ACACACACACACACACACGG |