| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.118532 |
| Chromosome: | chromosome 3 |
| Location: | 350861 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g144767 | (1 of 1) IPR002761//IPR014729 - Diphthamide synthase domain // Rossmann-like alpha/beta/alpha sandwich fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTCAGGTCAGGTCGGCTCAAGTGGCAGG |
| Internal bar code: | TTGTTAACTCGCTGTATTGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 670 |
| LEAP-Seq percent confirming: | 98.929 |
| LEAP-Seq n confirming: | 739 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCACACCTTCCCAATCAAC |
| Suggested primer 2: | AACCAATCCCGTAGGGAAAC |