| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.118559 |
| Chromosome: | chromosome 1 |
| Location: | 5139245 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g035750 | MSC3 | Mechanosensitive ion channel; (1 of 3) PTHR30566 - YNAI-RELATED MECHANOSENSITIVE ION CHANNEL | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGGCGTACGACGAGGACAGGTGGGCAG |
| Internal bar code: | ACGGTCGACATGGTGTATGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 929 |
| LEAP-Seq percent confirming: | 96.5001 |
| LEAP-Seq n confirming: | 7472 |
| LEAP-Seq n nonconfirming: | 271 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGTGCCTCGTAAAAGGAT |
| Suggested primer 2: | GTGCCTGGTTTGTGGTCTTT |