Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.118632 |
Chromosome: | chromosome 6 |
Location: | 3811109 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278166 | PRL4 | Predicted extracellular protein; (1 of 1) PTHR10334:SF165 - PATHOGENESIS-RELATED PROTEIN-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTACAAGGGTGCCTGGTGGTGACGTTGAC |
Internal bar code: | GAGCTTGAGGCGTGCATCATAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 823 |
LEAP-Seq percent confirming: | 94.5946 |
LEAP-Seq n confirming: | 910 |
LEAP-Seq n nonconfirming: | 52 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCTGCCAGTCTTTTGCCTT |
Suggested primer 2: | TGCTCTTTCCGTTCTGTCCT |