Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.118637 |
Chromosome: | chromosome 16 |
Location: | 6280000 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g674750 | (1 of 2) PF01857 - Retinoblastoma-associated protein B domain (RB_B) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAGGCATGTGCAGCGGACTGCAGGCGCG |
Internal bar code: | GCTTGATCTAAAGGAAATGCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 576 |
LEAP-Seq percent confirming: | 99.6392 |
LEAP-Seq n confirming: | 1933 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGGAGTGAATGTGGGAAT |
Suggested primer 2: | CAGGCTACTGTGCTGGTGAA |