| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.118689 |
| Chromosome: | chromosome 9 |
| Location: | 6987600 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g410800 | NRT2B,NAR4 | (1 of 4) K02575 - MFS transporter, NNP family, nitrate/nitrite transporter (NRT, narK, nrtP, nasA); High affinity nitrate transporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGGGTTGGTTAGCCACCTGCTCATCCA |
| Internal bar code: | GGTGGGGACTGACACTTTAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 665 |
| LEAP-Seq percent confirming: | 98.6466 |
| LEAP-Seq n confirming: | 656 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGAAAGACACGACGACAG |
| Suggested primer 2: | CTTCTCCATCTTCTGCCAGC |