Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.118764 |
Chromosome: | chromosome 17 |
Location: | 747097 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g701300 | (1 of 1) K17491 - protein phosphatase 4 regulatory subunit 3 (SMEK, PPP4R3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGACTGGCGAGTTGGGCGGCACAGGTGC |
Internal bar code: | TGGAGCGGCTGAGGATGTGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 150 |
LEAP-Seq percent confirming: | 59.3684 |
LEAP-Seq n confirming: | 282 |
LEAP-Seq n nonconfirming: | 193 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCACACGCTCTTCCAGTAG |
Suggested primer 2: | GACTTGTCGTGATGGTGGTG |