Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.118765 |
Chromosome: | chromosome 15 |
Location: | 964567 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g639150 | MDM38 | (1 of 1) K17800 - LETM1 and EF-hand domain-containing protein 1, mitochondrial (LETM1, MDM38); Mitochondrial distribution and morphology protein 38 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCGCGCAATCCCGCAGGTTCCCAGCGGG |
Internal bar code: | GTACAGCGAGGAGGGCAGGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 827 |
LEAP-Seq percent confirming: | 91.088 |
LEAP-Seq n confirming: | 4211 |
LEAP-Seq n nonconfirming: | 412 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAACTAACCCGGCAACTAA |
Suggested primer 2: | GGATGTGTGGATGTGCGTAG |