| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.118765 |
| Chromosome: | chromosome 15 |
| Location: | 964567 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g639150 | MDM38 | (1 of 1) K17800 - LETM1 and EF-hand domain-containing protein 1, mitochondrial (LETM1, MDM38); Mitochondrial distribution and morphology protein 38 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCGCGCAATCCCGCAGGTTCCCAGCGGG |
| Internal bar code: | GTACAGCGAGGAGGGCAGGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 827 |
| LEAP-Seq percent confirming: | 91.088 |
| LEAP-Seq n confirming: | 4211 |
| LEAP-Seq n nonconfirming: | 412 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACTAACCCGGCAACTAA |
| Suggested primer 2: | GGATGTGTGGATGTGCGTAG |