Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.118822 |
Chromosome: | chromosome 1 |
Location: | 7954589 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g066917 | LHCBM1 | (1 of 3) K08913 - light-harvesting complex II chlorophyll a/b binding protein 2 (LHCB2); Light-harvesting Chlorophyll a/b binding protein of LHCII | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACGTGCATCCGAATCTCACCCCACGTTC |
Internal bar code: | CGCAAATGCGAAGTTGATGCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 577 |
LEAP-Seq percent confirming: | 99.9551 |
LEAP-Seq n confirming: | 4457 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGTTTGTGTTGTCTGGTTG |
Suggested primer 2: | ACTACCTGGTGGCCTGTGTC |