Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.118925 |
Chromosome: | chromosome 17 |
Location: | 2391752 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g715200 | (1 of 21) IPR001611//IPR003591 - Leucine-rich repeat // Leucine-rich repeat, typical subtype | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCCATCTGGGAGATCTCCTCGGGCACC |
Internal bar code: | TTTATTTGCGTCCCCTCCGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 639 |
LEAP-Seq percent confirming: | 99.5327 |
LEAP-Seq n confirming: | 426 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACTGGAGCCAACATTAGCA |
Suggested primer 2: | CGTTTTCATTTCCCAGCATT |