| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.118942 |
| Chromosome: | chromosome 13 |
| Location: | 3162746 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g585301 | CPLD55,MGD1 | Monogalactosyldiacylglycerol synthase; (1 of 1) 2.4.1.46 - Monogalactosyldiacylglycerol synthase / Uridine diphosphogalactose-1,2-diacylglycerol galactosyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTGCGAGTGTGGGACCGTGGGACTACT |
| Internal bar code: | ACGCGCCTGATACCCGGGTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 851 |
| LEAP-Seq percent confirming: | 93.3067 |
| LEAP-Seq n confirming: | 3736 |
| LEAP-Seq n nonconfirming: | 268 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGAGGTCCATTGAATTGTT |
| Suggested primer 2: | GGGAATGGACATGGTACTGG |