Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.119140 |
Chromosome: | chromosome 10 |
Location: | 726634 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g422700 | SMM35 | (1 of 25) IPR013216//IPR029063 - Methyltransferase type 11 // S-adenosyl-L-methionine-dependent methyltransferase; S-adenosyl-L-methionine-dependent methyltransferase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCAACAGCCACCAAGGTACGTGCCGCC |
Internal bar code: | GCCTCAGCGCAACGTCGGCGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 495 |
LEAP-Seq percent confirming: | 99.7799 |
LEAP-Seq n confirming: | 5439 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGCGCAAATTCTGCTTTA |
Suggested primer 2: | GCTTCCTGGTCGCTTTGTAG |