Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.119291 |
Chromosome: | chromosome 10 |
Location: | 2919356 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g440250 | PGM19 | Putative phosphoglycerate mutase; (1 of 1) 3.1.3.80 - 2,3-bisphosphoglycerate 3-phosphatase / 2,3-BPG 3-phosphatase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATGCGCCGCCCCCATCCTCCTGCACAC |
Internal bar code: | CTCGGCATTCGTGGCAGCAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 802 |
LEAP-Seq percent confirming: | 99.2889 |
LEAP-Seq n confirming: | 5306 |
LEAP-Seq n nonconfirming: | 38 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAGCTTGGCAAAATGACTG |
Suggested primer 2: | CGAAGAACTGAGGCAAGTCC |